View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11152_high_13 (Length: 330)
Name: NF11152_high_13
Description: NF11152
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11152_high_13 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 138; Significance: 4e-72; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 138; E-Value: 4e-72
Query Start/End: Original strand, 2 - 159
Target Start/End: Original strand, 55170116 - 55170273
Alignment:
| Q |
2 |
atcatttgatggagtttggtaacattattatgttgtcattgacaaacaccaactttagatacgtacagatccatatcaacctgtctcacagttatactta |
101 |
Q |
| |
|
||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
55170116 |
atcatttgatggagtttggtaacattattgttttgtcattgacaaacaccaactttagatacgtacagatctatatcaacctgtctcacagttatactta |
55170215 |
T |
|
| Q |
102 |
ctaccttttccttttgtttcctaatttctaattctaactatgaccgattgtctgttaa |
159 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||| |
|
|
| T |
55170216 |
ctaccttttccttttgtttcctaatttctaattctaattatgacagattgtctgttaa |
55170273 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 167 - 323
Target Start/End: Original strand, 55170346 - 55170506
Alignment:
| Q |
167 |
aatggtccttacaaacaaatattcataattttggatagtatttt--ttaagtacaaaaaggttacaactgtgacaatctatgattgccgtgtttacat-- |
262 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
55170346 |
aatggtccttacaaacaaatattcagaattttggatagtattttttttaagtacaaaaaggttacaactgggacaatctatgattgccgtgtttacattg |
55170445 |
T |
|
| Q |
263 |
tgattcgaatccagnnnnnnncttcttatgcacttgattttctttcatttcagaataatat |
323 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55170446 |
tgattcgaatccagtttttttcttcttatgcacttgattttctttcatttcagaataatat |
55170506 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University