View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11152_high_21 (Length: 301)
Name: NF11152_high_21
Description: NF11152
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11152_high_21 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 261; Significance: 1e-145; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 261; E-Value: 1e-145
Query Start/End: Original strand, 1 - 292
Target Start/End: Complemental strand, 16946951 - 16946662
Alignment:
| Q |
1 |
catccatcttgtttgtaggttaaaatgaaattaaacagttacattcactccggttttcaatttaagtaaaaattgttaaaactaaagacacttttatttc |
100 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16946951 |
catccatcttgtttgtaggttaaaataaaattaaacagttacattcactccggttttcaatttaagtaaaaattgttaaaactaaagacacttttatttc |
16946852 |
T |
|
| Q |
101 |
attttatagaagtgattatataaacaattgaattaaaaaatgtgcaccaataatgatacttctcaaaatgaggttatttaatttaagacattctaaagtt |
200 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||| |
|
|
| T |
16946851 |
attttataaaagtgattatataaacaattgaattaaaaaatgtgcaccaataatgatacttctcaaaatgaggtgatttaatttaacacattctaaagtt |
16946752 |
T |
|
| Q |
201 |
aataagatcatacaagatggtgtattgtaactttctatggtcattaatactgcagaaatcaccctatctgttccattcaaagtcttcatctc |
292 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||| |
|
|
| T |
16946751 |
aataagatcatacaagatggtgtattgtaactttctatggtcattaatactgcag--atcaccctatctgttccattcaaagtcttcttctc |
16946662 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University