View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11152_low_5 (Length: 201)
Name: NF11152_low_5
Description: NF11152
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11152_low_5 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 14 - 185
Target Start/End: Original strand, 2785917 - 2786088
Alignment:
| Q |
14 |
aacctgtgtagaagcagtaagatatcccgaactagtaattactgatggtccagaaaatgccgtgccacgctcaatttttacgccacgctcaacttttacc |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||| |||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
2785917 |
aacctgtgtagaagcagtaagatatcccgaactagtaattactggcggtccagaagatgtcgtgccacgctcaatttttacgacacgctcaacttttacc |
2786016 |
T |
|
| Q |
114 |
ggcaatggctcaacttttacaggcactggctcaacttttacagtagcaggagtcacattcacattaggtatt |
185 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| | |||||||||||| |
|
|
| T |
2786017 |
ggcaatggctcaacttttacaggcactggctcagcttttacagtagcaggagtcacactgacattaggtatt |
2786088 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 14 - 67
Target Start/End: Complemental strand, 22520342 - 22520289
Alignment:
| Q |
14 |
aacctgtgtagaagcagtaagatatcccgaactagtaattactgatggtccaga |
67 |
Q |
| |
|
|||||||| ||||||||||||| |||| |||||||| |||||||| |||||||| |
|
|
| T |
22520342 |
aacctgtgcagaagcagtaagagatccagaactagttattactgacggtccaga |
22520289 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University