View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11153_high_1 (Length: 305)
Name: NF11153_high_1
Description: NF11153
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11153_high_1 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 158; Significance: 4e-84; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 158; E-Value: 4e-84
Query Start/End: Original strand, 136 - 297
Target Start/End: Original strand, 1036770 - 1036931
Alignment:
| Q |
136 |
agtatgatacaatagcgtagtaaatcaaatcttataaacatttcaacttgatcatgattcaacactagagtttcacaagcttgttctacaatatcttttg |
235 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
1036770 |
agtatgatacaatagcgtagtaaatcaaatcttataaacatttcaacttgatcatgattcaacactagagtttcacaagcttgttgtacaatatcttttg |
1036869 |
T |
 |
| Q |
236 |
aaatgaaatatatcaataagaaaccatgtcaattgaaatagatcatgccatttgcctatgct |
297 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1036870 |
aaatgaaatatatcaataagaaaccatgtcaattgaaatagatcatgccatttgcctatgct |
1036931 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 17 - 76
Target Start/End: Original strand, 1036651 - 1036710
Alignment:
| Q |
17 |
acaaactgtagttgttttgcaatagatgatttatgcacaagataatgtaaactcactgta |
76 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||| |
|
|
| T |
1036651 |
acaaactgtagttgttttgcaatagatgaattatgcacaagataatgtaaagtcactgta |
1036710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University