View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11153_low_2 (Length: 319)
Name: NF11153_low_2
Description: NF11153
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11153_low_2 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 223; Significance: 1e-123; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 1 - 268
Target Start/End: Original strand, 36310029 - 36310295
Alignment:
| Q |
1 |
gctgggagttttccttcggtgcattttcatgttcctggccaaaatgcaaaaggagaggaaggaatatttgttttgatttccttacctactaaagttatga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36310029 |
gctgggagttttccttcggtgcattttcatgttcctggccaaaatgcaaaaggagaggaaggaatatttgttttgatttccttacctactaaagttatga |
36310128 |
T |
|
| Q |
101 |
cagcttttgccaaagagttggatgacttaattgcagcaacaaattaagccaccttatctatttttagattgtctatttgaaaccgcaaataataaagtct |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||| ||||||||||||||||| |
|
|
| T |
36310129 |
cagcttttgccaaagagttggatgacttaattgcagcaacaaattaagccactttatctatttttagaatgtctatttgaaaacgcaaataataaagtct |
36310228 |
T |
|
| Q |
201 |
gagagtggttacgttgtttgcattcaagctcnnnnnnnacgcaatggttggcttgttgtggatttggt |
268 |
Q |
| |
|
||||||||||||||||||||||||||||||| | |||||||||||||| ||||||||||||| |
|
|
| T |
36310229 |
gagagtggttacgttgtttgcattcaagctctttgtttatgcaatggttggctt-ttgtggatttggt |
36310295 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 270 - 301
Target Start/End: Original strand, 36310376 - 36310407
Alignment:
| Q |
270 |
taatctagaccatccattttgatattaatggt |
301 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
36310376 |
taatctagaccatccattttgatattaatggt |
36310407 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University