View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11154_high_11 (Length: 370)
Name: NF11154_high_11
Description: NF11154
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11154_high_11 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 308; Significance: 1e-173; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 308; E-Value: 1e-173
Query Start/End: Original strand, 9 - 352
Target Start/End: Complemental strand, 41205104 - 41204761
Alignment:
| Q |
9 |
agcacagatggcttggctgcagttgccgctaattgcaagtaagatttacgtgtcttcaaactttattttatgatcctggagaaaagttgacgagaatgac |
108 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41205104 |
agcactgatggcttggctgcagttgccgctaattgcaagtaagatttacgtgtcttcaaactttattttatgatcctggagaaaagttgacgagaatgac |
41205005 |
T |
|
| Q |
109 |
aatttttccataattcatagattgatttattacgattcactaaaatacaggacatttataaatagagtttaattttgatatactgttggcataaaatact |
208 |
Q |
| |
|
|||||| | |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
41205004 |
aattttccattaattcatagattgatttattaggattcactaaaatacaggacatttataaatagagtttaattttgatatactgttggcataaaatatt |
41204905 |
T |
|
| Q |
209 |
tttaatgatccggcgattataattgattgacggtgtaaaaattttacactaaccatgcatggtagttgaatccatataaatacttgtggaactttagttt |
308 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
41204904 |
tttaatgatccggcgattataattgattgacggtgtaaaaattttacactaaccatgcatactagttgaatccatataaatacttgtggaactttaattt |
41204805 |
T |
|
| Q |
309 |
cctcattgttgcataattaaaatgcgatttaacagggaaacctt |
352 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41204804 |
cctcattgttgcataattaaaatgcgatttaacagggaaacctt |
41204761 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University