View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11154_high_17 (Length: 250)
Name: NF11154_high_17
Description: NF11154
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11154_high_17 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 78; Significance: 2e-36; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 1 - 90
Target Start/End: Original strand, 30240388 - 30240477
Alignment:
| Q |
1 |
agtaaggagtttggagtttgaatcccattatctacatatttcaatttatgttttatatcaaccgaattatgctcacgtggattagtaggg |
90 |
Q |
| |
|
||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
30240388 |
agtaaggagtttggagtttgaatcccattctctgcatatttcaatttatgttttatatcaaccgaatcatgctcacgtggattagtaggg |
30240477 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 183 - 242
Target Start/End: Original strand, 30240528 - 30240587
Alignment:
| Q |
183 |
aatctttaatacgcggatgatgacgcactcaacatgatcaccacatgtgatgtctctgct |
242 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||| |
|
|
| T |
30240528 |
aatctttaatacgcggatgatgacgcactcaacatgatcaccacacgtgatgtcgctgct |
30240587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 61; Significance: 3e-26; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 8 - 84
Target Start/End: Original strand, 34675451 - 34675527
Alignment:
| Q |
8 |
agtttggagtttgaatcccattatctacatatttcaatttatgttttatatcaaccgaattatgctcacgtggatta |
84 |
Q |
| |
|
|||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
34675451 |
agtttggagtttgaatcccattctctgtatatttcaatttatgttttatatcaaccgaattatgctcacgaggatta |
34675527 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 56; Significance: 3e-23; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 1 - 89
Target Start/End: Original strand, 26974892 - 26974982
Alignment:
| Q |
1 |
agtaaggagtttggagttt--gaatcccattatctacatatttcaatttatgttttatatcaaccgaattatgctcacgtggattagtagg |
89 |
Q |
| |
|
|||||| |||||||||||| ||||| |||| ||| ||||||||||||||||||||| ||||||||||||||||||||| ||||||||||| |
|
|
| T |
26974892 |
agtaagaagtttggagtttttgaatctcattctctgcatatttcaatttatgttttacatcaaccgaattatgctcacgaggattagtagg |
26974982 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 182 - 226
Target Start/End: Original strand, 26975073 - 26975117
Alignment:
| Q |
182 |
caatctttaatacgcggatgatgacgcactcaacatgatcaccac |
226 |
Q |
| |
|
||||||||||||| ||| ||||||| |||||||||| |||||||| |
|
|
| T |
26975073 |
caatctttaatacacgggtgatgacacactcaacataatcaccac |
26975117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University