View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11154_low_12 (Length: 363)
Name: NF11154_low_12
Description: NF11154
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11154_low_12 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 313; Significance: 1e-176; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 313; E-Value: 1e-176
Query Start/End: Original strand, 16 - 348
Target Start/End: Complemental strand, 12777329 - 12776997
Alignment:
| Q |
16 |
atgaagagaggtgaatcttaaattcaatgtcttaatgttttgagtggagatgttatttcaagtcttcttgatgttcctgatcatttgtctcttgttgctc |
115 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||| |
|
|
| T |
12777329 |
atgaagagaggtcaatcttaaattcaatgtcttaatgttttgagtggagatgttatttcaagtcttcatggtgttcctgatcatttgtctcttgttgctc |
12777230 |
T |
|
| Q |
116 |
gtgctcctccgtattttccaacaagtggtatattagagtctggttcgacttggtggaggagaaagatggatccatatgcaatggatcaaagtatagtgat |
215 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12777229 |
gtgctcctccgtattttccaacaagttgtatattagagtctggttcgacttggtggaggagaaagatggatccatatgcaatggatcaaagtatagtgat |
12777130 |
T |
|
| Q |
216 |
gtgggagattcacttgagacagatcattggagtacaagtgtgagtagttactctccctcatcaagtatgaatggattaaacgaatgatataaaaaagaga |
315 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
12777129 |
gtgggagattcacttgagacagatcattggagtacaagtgtgagtagttactctccctcatcaagtatgaaaggattaaacgaatgatataaaaaagaga |
12777030 |
T |
|
| Q |
316 |
tggtgatttatatgttcaatgtcttatgttttt |
348 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
12777029 |
tggtgatttatatgttcaatgtcttatgttttt |
12776997 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University