View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11154_low_22 (Length: 240)
Name: NF11154_low_22
Description: NF11154
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11154_low_22 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 192; Significance: 1e-104; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 18 - 213
Target Start/End: Complemental strand, 33387138 - 33386943
Alignment:
| Q |
18 |
acaaagaggagtaataagaccaacacaatcattattatgtaggaagtggtagcttacctatgtcacatactgaatgatctgaccaatctgaatatatgga |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33387138 |
acaaagaggagtaataagaccaacacaatcattaatatgtaggaagtggtagcttacctatgtcacatactgaatgatctgaccaatctgaatatatgga |
33387039 |
T |
|
| Q |
118 |
ataaaaccaatttttgcatcacgtacattggcccggttaaaagttttccaatgtcacgttttagtttcttttcaaaatttgtttatatatgcctct |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33387038 |
ataaaaccaatttttgcatcacgtacattggcccggttaaaagttttccaatgtcacgttttagtttcttttcaaaatttgtttatatatgcctct |
33386943 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 176 - 204
Target Start/End: Complemental strand, 33386107 - 33386079
Alignment:
| Q |
176 |
ttttagtttcttttcaaaatttgtttata |
204 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
33386107 |
ttttagtttcttttcaaaatttgtttata |
33386079 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University