View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11154_low_24 (Length: 201)
Name: NF11154_low_24
Description: NF11154
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11154_low_24 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 81; Significance: 2e-38; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 81; E-Value: 2e-38
Query Start/End: Original strand, 62 - 162
Target Start/End: Original strand, 42561160 - 42561260
Alignment:
| Q |
62 |
ttcatttctctagtttggagtaagagagaaattgagacgatagattaaattggatgggatccacaccttttttgcatctcctcaaaacaggagagaaaca |
161 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||| |||||||||||||| ||||| |||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
42561160 |
ttcatttctctagtttggagtaggagagaaattgagacaatagattaaattggctgggacccacaccttttttgcatctcctcaaaacagcagagaaaca |
42561259 |
T |
|
| Q |
162 |
c |
162 |
Q |
| |
|
| |
|
|
| T |
42561260 |
c |
42561260 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 69; Significance: 4e-31; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 62 - 161
Target Start/End: Complemental strand, 18604569 - 18604469
Alignment:
| Q |
62 |
ttcatttctctagtttggagtaagagagaaattgagacgatagattaaattggatgggatccacacctt-ttttgcatctcctcaaaacaggagagaaac |
160 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||| |||||||||||||| ||||| ||||||||| ||||||||||||||||||||| | |||||| |
|
|
| T |
18604569 |
ttcatttctctagtttggagtaggagagaaattgagacaatagattaaattggctgggacccacacctttttttgcatctcctcaaaacagcatagaaac |
18604470 |
T |
|
| Q |
161 |
a |
161 |
Q |
| |
|
| |
|
|
| T |
18604469 |
a |
18604469 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University