View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11155_high_11 (Length: 215)
Name: NF11155_high_11
Description: NF11155
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11155_high_11 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 13 - 199
Target Start/End: Complemental strand, 19796780 - 19796594
Alignment:
| Q |
13 |
gcagagagaatgatgttgaacccttgcatagaaaattcatgaagaaaacttgagaaactatcatcactggaaatcaaaagaatattggcagggggaggat |
112 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19796780 |
gcagaaagaatgatgttgaacccttgcatagaaaattcatgaagaaaacttgagaaactatcatcactggaaatcaaaagaatattggcagggggaggat |
19796681 |
T |
 |
| Q |
113 |
tctgtaacgcccatattaacaaatccggcatgatcccattgtagacacctgaaataaaaactcggttatgattgattatggagaagt |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19796680 |
tctgtaacgcccatattaacaaatccggcatgatcccattgtagacacctgaaataaaaactcggttatgattgattatggagaagt |
19796594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University