View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11155_low_14 (Length: 215)
Name: NF11155_low_14
Description: NF11155
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11155_low_14 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 1 - 199
Target Start/End: Complemental strand, 10222231 - 10222033
Alignment:
| Q |
1 |
agaacaaaattgtgtatacattgggcacaagtcaagttagcagcaagcaagtaatgcttccccgcattgtttccattgtgtttgctcacgtggccttgtc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10222231 |
agaacaaaattgtgtatacattgggcacaagtcaagttagcagcaagcaagtaatgcttccccgcattgtttccattgtgtttgctcacgtggccttgtc |
10222132 |
T |
 |
| Q |
101 |
tgttttggtcttcagcattcgatcgaagggccacattgccgaatatcaccgactgagaaatgataattcatctagtctcatcgtcatcaggaccaaaat |
199 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10222131 |
tgttttggtcttcagcattcgatcgaaggaccacattgccgaatatcaccgactgagaaatgataattcatctagtctcatcgtcatcaggaccaaaat |
10222033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University