View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11157_high_5 (Length: 240)
Name: NF11157_high_5
Description: NF11157
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11157_high_5 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 18 - 227
Target Start/End: Complemental strand, 36534612 - 36534403
Alignment:
| Q |
18 |
atacttaccctaataatgtggaagaaagagtgcgtttttggcctataactacaacatcaaccccttgatctaaggtatgtaagagaatagtgttagccct |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
36534612 |
atacttaccctaataatgtggaagaaagagtgcgtttttggcctataactacaacatcaacccgttgatctaaggtatgtaagagaatagtgttagccct |
36534513 |
T |
|
| Q |
118 |
atcttttccattatctatttcaaccttcattgtacgaactttcaatctaggttgagcagctttacaggcattcttcatttcttcaagaaaatcaaccacc |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36534512 |
atcttttccattatctatttcaaccttcattgtacgaactttcaatttaggttgagcagctttacaggcattcttcatttcttcaagaaaatcaaccacc |
36534413 |
T |
|
| Q |
218 |
gtctctccct |
227 |
Q |
| |
|
|||||||||| |
|
|
| T |
36534412 |
gtctctccct |
36534403 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University