View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11157_low_3 (Length: 350)
Name: NF11157_low_3
Description: NF11157
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11157_low_3 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 93; Significance: 3e-45; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 93; E-Value: 3e-45
Query Start/End: Original strand, 36 - 150
Target Start/End: Original strand, 2418543 - 2418661
Alignment:
| Q |
36 |
tcaatagaactttttattt--taattgataaagtacaatataaaataatcaaacagatcacagatcctaaaagcaagcagggtccactttgatgcatca- |
132 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
2418543 |
tcaatagaactttttatttattaattgataaagtacaatataaaataatcaaacagatcacagatcctaaaagcaagcagggtccactctgatgcatcag |
2418642 |
T |
 |
| Q |
133 |
-gtgatccccaccaccaaa |
150 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
2418643 |
tgtgatccccaccaccaaa |
2418661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 292 - 332
Target Start/End: Original strand, 2418798 - 2418838
Alignment:
| Q |
292 |
aataaaacagtaccatgctgaggaaatttccaccaccacca |
332 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2418798 |
aataaaacagtaccatgctgaggaaatttccaccaccacca |
2418838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University