View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11157_low_4 (Length: 331)
Name: NF11157_low_4
Description: NF11157
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11157_low_4 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 281; Significance: 1e-157; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 281; E-Value: 1e-157
Query Start/End: Original strand, 23 - 331
Target Start/End: Original strand, 38632394 - 38632701
Alignment:
| Q |
23 |
tgcttagtagttaaagccattgattggaaaatcattgatagagactccgctcataatcattaatgcatgcacaattaattataacaaactatgtctatga |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38632394 |
tgcttagtagttaaagccattgattggaaaatcattgatagagactccgctcataatcattaatgcatgcacaattaattataacaaactatgtctatga |
38632493 |
T |
 |
| Q |
123 |
agtaatttaaatctttacttcgatttttcaatcaataacttggaaatgcaaggtaaggctgcctatttgagccttctttgcaagatcgaaacagatgtat |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
38632494 |
agtaatttaaatctttacttcgatttttcaatcaataacttgaaaatgcaaggtaaggctgcctatttgagccttctttgcacgatcgaaacagatgtat |
38632593 |
T |
 |
| Q |
223 |
ccagtactctctcttgaatctttcatacattttgttgaaaaatatgatagcaaaagtcagttattttatcagacgagggaacagcatattcagcctttgc |
322 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
38632594 |
ccagtactctctcttgaatctttcataca-tttgttgaaaaatatgatagcaaaagtcagttattttatcagacgaggaaacagcatattcagcctttgt |
38632692 |
T |
 |
| Q |
323 |
ttctcctct |
331 |
Q |
| |
|
|| |||||| |
|
|
| T |
38632693 |
ttttcctct |
38632701 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University