View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11158_low_2 (Length: 407)
Name: NF11158_low_2
Description: NF11158
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11158_low_2 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 386; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 386; E-Value: 0
Query Start/End: Original strand, 1 - 390
Target Start/End: Complemental strand, 45319264 - 45318875
Alignment:
| Q |
1 |
gtttttcaccaaatccccttctgtttgacttttggaacgtttcttcacatggagagaatatggtttagaacttgcttggactatgtcactgttactgtgt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45319264 |
gtttttcaccaaatccccttctgtttgacttttggaacgtttcttcacatggagagaatatggtttagaacttgcttggactatgtcactgttactgtgt |
45319165 |
T |
 |
| Q |
101 |
tccatggacacatttgtttcttcaaagggtgttttttcatttgttacttccttgatgtcaacaatatagttgggatctgcatgttttgaagctagaggag |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45319164 |
tccatggacacatttgtttcttcaaagggtgttttttcatttgttacttccttgatgtcaacaatatagttgggatctgcatgttttgaagctagaggag |
45319065 |
T |
 |
| Q |
201 |
aagcatttgaacttcttcttgatttctttgtcccttccaacgaaattacaatttctcctgaaacattggttttcctttccctccttttctgtgatgtaat |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
45319064 |
aagcatttgaacttcttcttgatttctttgtcccttccaacgaaattacaatttctcctgaaacattggttttcctttccctccttttctgtgatgtact |
45318965 |
T |
 |
| Q |
301 |
ccatggttttgtttcagtggcatgctgaataccatatttgcataaatcatggcaggaactcgcacgatcacgaagataacgtgaaagaat |
390 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45318964 |
ccatggttttgtttcagtggcatgctgaataccatatttgcataaatcatggcaggaactcgcacgatcacgaagataacgtgaaagaat |
45318875 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University