View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11159_high_12 (Length: 293)
Name: NF11159_high_12
Description: NF11159
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11159_high_12 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 20 - 271
Target Start/End: Complemental strand, 33177185 - 33176933
Alignment:
| Q |
20 |
gggttcctattgactactcactactatttcatccaaggagttctgatcggagtgtttttccattgttgtgatcctctagtaaactttatttgttatttaa |
119 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33177185 |
gggttcctatcgactactcactactatttcatccaaggagttctaatcggagtgtttttccattgttgtgatcctctagtaaactttatttgttatttaa |
33177086 |
T |
 |
| Q |
120 |
agcctctgcggacctctttcccttgagcttgtttttaggactctattattctgcaccaccatgggctcttcacgaattttctcttgcaatttttggttta |
219 |
Q |
| |
|
||||| ||||| ||| |||||||||||||| ||| ||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33177085 |
agccttggcggatctcgttcccttgagcttgatttcaggactctattattcggcaccgccatgggctcttcacgaattttctcttgcaatttttggttta |
33176986 |
T |
 |
| Q |
220 |
aaaatattggatttagttttttctggattcaagatat-ggtttctttcattat |
271 |
Q |
| |
|
|||||||||||||||||| ||||||| |||||||||| ||||||||||||||| |
|
|
| T |
33176985 |
aaaatattggatttagttgtttctgggttcaagatatgggtttctttcattat |
33176933 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 66; Significance: 3e-29; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 22 - 154
Target Start/End: Complemental strand, 23356923 - 23356790
Alignment:
| Q |
22 |
gttcctattgactactcactactatttcatccaaggagttctgatcggagtgtttttc-cattgttgtgatcctctagtaaactttatttgttatttaaa |
120 |
Q |
| |
|
||||| || |||| |||||||||||||||||||||| || ||||||||||||||||| | |||||||| |||||||||||||||||||||| ||||| | |
|
|
| T |
23356923 |
gttccaatagacttctcactactatttcatccaaggggtactgatcggagtgtttttgtccttgttgtggtcctctagtaaactttatttgtgatttaga |
23356824 |
T |
 |
| Q |
121 |
gcctctgcggacctctttcccttgagcttgtttt |
154 |
Q |
| |
|
|||| |||| |||| ||| |||||||||||||| |
|
|
| T |
23356823 |
gccttcgcggtcctcgttcacttgagcttgtttt |
23356790 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 209 - 254
Target Start/End: Complemental strand, 23356753 - 23356708
Alignment:
| Q |
209 |
tttttggtttaaaaatattggatttagttttttctggattcaagat |
254 |
Q |
| |
|
||||||||||||||||||||||||| ||| ||||| |||||||||| |
|
|
| T |
23356753 |
tttttggtttaaaaatattggatttggttgtttctagattcaagat |
23356708 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University