View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11159_high_9 (Length: 319)
Name: NF11159_high_9
Description: NF11159
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11159_high_9 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 247; Significance: 1e-137; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 11 - 273
Target Start/End: Complemental strand, 41290023 - 41289761
Alignment:
| Q |
11 |
catcatcactcctctcatcgtctctcacatcaacgatggcgatggttggttggcgtttgagagagagaagctcggagcctgtgacgtatgagatactgtg |
110 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
41290023 |
catcataactcctctcatcgtctctcacatcaacgatggcgatggttggttggcgtttgagagagagaagctcggagcctgttacgtatgagatactgtg |
41289924 |
T |
 |
| Q |
111 |
agccatcttctctactggtaattcactatttctacgctgactactctttccgactcccatgcctctcagattgacttttatttggggaaacagaggctgg |
210 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
41289923 |
agccatcttctctgctggtaattcactatttctacgctgactactctttccgactcccatgcctctcagattgacttttatttggggaaacagacgctgg |
41289824 |
T |
 |
| Q |
211 |
ccccgaatccaactcattttgcaacccaaccggatgcatgcacacggtgcacttttcattaac |
273 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41289823 |
ccccgaatccaactcattttgcaacccaaccggatgcatgcacacggtgcacttttcattaac |
41289761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University