View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11159_low_17 (Length: 242)
Name: NF11159_low_17
Description: NF11159
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11159_low_17 |
 | |
|
| [»] chr1 (2 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 139; Significance: 7e-73; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 139; E-Value: 7e-73
Query Start/End: Original strand, 104 - 242
Target Start/End: Complemental strand, 35817245 - 35817107
Alignment:
| Q |
104 |
caaatatttcttattaatttgtttaagatatgacacatggaaaccaaatactaaataaacataaactgagataagcttgtgtcagccccgtgatttgggg |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35817245 |
caaatatttcttattaatttgtttaagatatgacacatggaaaccaaatactaaataaacataaactgagataagcttgtgtcagccccgtgatttgggg |
35817146 |
T |
|
| Q |
204 |
ctgttctaaatgcaatgatccctgacttcaattcttctc |
242 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35817145 |
ctgttctaaatgcaatgatccctgacttcaattcttctc |
35817107 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 38
Target Start/End: Complemental strand, 35817347 - 35817310
Alignment:
| Q |
1 |
tgttggataatgattcaaggtaagccaaatagttgtaa |
38 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35817347 |
tgttggataatgattcaaggtaagccaaatagttgtaa |
35817310 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University