View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1115_high_10 (Length: 291)
Name: NF1115_high_10
Description: NF1115
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1115_high_10 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 46; Significance: 3e-17; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 20 - 77
Target Start/End: Original strand, 25377071 - 25377128
Alignment:
| Q |
20 |
caagtacatgttggaccaattttttcataggtccaaattatactcaaccccacataat |
77 |
Q |
| |
|
|||||| ||||||||||||||||| |||||||||||||||||||||||||||| |||| |
|
|
| T |
25377071 |
caagtatatgttggaccaatttttccataggtccaaattatactcaaccccacgtaat |
25377128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 26 - 68
Target Start/End: Complemental strand, 41422327 - 41422285
Alignment:
| Q |
26 |
catgttggaccaattttttcataggtccaaattatactcaacc |
68 |
Q |
| |
|
|||||||||||||||||| ||||| ||||||||||||| |||| |
|
|
| T |
41422327 |
catgttggaccaatttttccatagatccaaattatactgaacc |
41422285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University