View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1115_high_16 (Length: 259)
Name: NF1115_high_16
Description: NF1115
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1115_high_16 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 211; Significance: 1e-116; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 29 - 246
Target Start/End: Original strand, 39116127 - 39116345
Alignment:
| Q |
29 |
accattagatagatcct-atggcaaaagtaacatttgttttgcttgaggaggaacatatggttgactgcatcaaaacatcaagacaatattattagaaaa |
127 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39116127 |
accattagatagatccttatggcaaaagtaacatttgttttgcttgaggaggaacatatggttgactgcatcaaaacatcaagacaatattattagaaaa |
39116226 |
T |
|
| Q |
128 |
aatatgtaaaaatatagcagaaagctttgtgagtttttgttcttaaccttacccagtccagacgcaagtgcacatagcagataggtttgtgtcaaagaag |
227 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39116227 |
aatatgtaaaaatatagcagaaagctttgtgagtttttgttcttaaccttacccagtccagacgcaagtgcacatagcagataggtttgtgtcaaagaag |
39116326 |
T |
|
| Q |
228 |
aaaggtttgtgtctaagaa |
246 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
39116327 |
aaaggtttgtgtctaagaa |
39116345 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 86 - 135
Target Start/End: Original strand, 37033061 - 37033110
Alignment:
| Q |
86 |
tggttgactgcatcaaaacatcaagacaatattattagaaaaaatatgta |
135 |
Q |
| |
|
||||| |||||||| |||||| |||||| | ||||||||||||||||||| |
|
|
| T |
37033061 |
tggttaactgcatccaaacattaagacagtgttattagaaaaaatatgta |
37033110 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University