View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1115_low_10 (Length: 332)
Name: NF1115_low_10
Description: NF1115
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1115_low_10 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 170; Significance: 3e-91; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 170; E-Value: 3e-91
Query Start/End: Original strand, 76 - 249
Target Start/End: Original strand, 24224909 - 24225082
Alignment:
| Q |
76 |
attcgacgtcgaggccgacgaggacggggaatggggggtggaggtggagggtttcgaggagccaggtgtcgacgacggagggtgtggaggttaagaggga |
175 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24224909 |
attcgacgtcgaggccgacgaggacggggaatggggggtggaggcggagggtttcgaggagccaggtgtcgacgacggagggtgtggaggttaagaggga |
24225008 |
T |
|
| Q |
176 |
ttggattgtgaaggtggagtcgaaggtgatggagtaggtgtcgtgggtatcgtgagggaggttgttgtcgatga |
249 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24225009 |
ttggattgtgaaggtggagtcgaaggtgatggagtaggtgtcgtgggtatcgtgagggaggttgttgtcgatga |
24225082 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 170 - 246
Target Start/End: Complemental strand, 24229124 - 24229048
Alignment:
| Q |
170 |
gagggattggattgtgaaggtggagtcgaaggtgatggagtaggtgtcgtgggtatcgtgagggaggttgttgtcga |
246 |
Q |
| |
|
||||| ||||||||||| ||||| ||||| ||||||||||||||||| |||||| |||| ||||||| |||||||| |
|
|
| T |
24229124 |
gagggtttggattgtgagggtggtgtcgatggtgatggagtaggtgttgtgggtgtcgtaggggaggtggttgtcga |
24229048 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University