View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1115_low_13 (Length: 320)

Name: NF1115_low_13
Description: NF1115
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1115_low_13
NF1115_low_13
[»] chr4 (1 HSPs)
chr4 (39-127)||(32767351-32767439)


Alignment Details
Target: chr4 (Bit Score: 73; Significance: 2e-33; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 39 - 127
Target Start/End: Original strand, 32767351 - 32767439
Alignment:
39 aacgatgtggtttggttgataagctaagagctgttgacggatgaaatgttgcgtttaatcacaaaaaactaatgtaactattaatattt 127  Q
    |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| | |||||||||| ||||||||||||||||    
32767351 aacgatgtggtttggttgataagctaagagctgttgactgatgaaatgttgcgtttaataaaaaaaaactaacgtaactattaatattt 32767439  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University