View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1115_low_22 (Length: 284)
Name: NF1115_low_22
Description: NF1115
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1115_low_22 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 29 - 233
Target Start/End: Original strand, 8322522 - 8322723
Alignment:
| Q |
29 |
acttagcactgctgataataattttaattggaagacaatattaagtagagttattagatgcataatctcgtatagtgtggcattaagtttgcattaataa |
128 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
8322522 |
acttagtactgctgataataattttaattggaagacaatattaagtagagtta---gatgcataatctcgtataatgtggcattaagtttgcattaataa |
8322618 |
T |
 |
| Q |
129 |
tatggaataactgtgcaaacaaaaatctcatgtagtgaaacattttggcctacaataaacaattaacattaatatgtaagaaaaattattgtttaacgtt |
228 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8322619 |
tatggaataactgtgcaaacaaaaatctcatgtagtgaaacattttggcctacaataatcaattaacattaatatgtaagaaaaattattgtttaacgtt |
8322718 |
T |
 |
| Q |
229 |
gaaac |
233 |
Q |
| |
|
||||| |
|
|
| T |
8322719 |
gaaac |
8322723 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University