View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1115_low_29 (Length: 238)
Name: NF1115_low_29
Description: NF1115
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1115_low_29 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 1 - 188
Target Start/End: Original strand, 16910669 - 16910856
Alignment:
| Q |
1 |
tggggtgtccgttggatgatgaaaattccaacttccttggaattgcctgctttgaaaagcttgcatcttatctctgtcacttttgttgcaaatgataatg |
100 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||| |
|
|
| T |
16910669 |
tggggtgtcccttggatgatgaaaattccaacttccttggaattgcctgctttgaaaagcttgcatcttatctctgccacttttgttgcaaatgacaatg |
16910768 |
T |
|
| Q |
101 |
gcattgtggaacccttttcaaattttaagatgttaagcaccttggttcttgactgttggtgtctacaacacaatgcaactgtcctctg |
188 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||| ||| ||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
16910769 |
gcattgtggaacccttttcaaattttaagatgttaagcactttggtccttaactgttggtctctacaacacaatgcaactgtcctctg |
16910856 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University