View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11160_high_20 (Length: 229)
Name: NF11160_high_20
Description: NF11160
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11160_high_20 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 14 - 214
Target Start/End: Complemental strand, 37385762 - 37385559
Alignment:
| Q |
14 |
cagagaaagaaccttctatacacaaaca---ttctgtgcttccttttgcttcaatggcttgatctctccttagtaaagagtgctaaggttccggcgatca |
110 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37385762 |
cagagaaagaaccttctatacacaaacaatattctgtgcatccttttgcttcaatggcttgatctctccttagtaaagagtgctaaggttccggcgatca |
37385663 |
T |
 |
| Q |
111 |
tagtgttcggcgactcatccgtggatgccgggaacaacaacttcatatcgacggttgctcggagcaatttccagccgtatggacgtgattttctgggtgg |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37385662 |
tagtgttcggcgactcatccgtggatgccgggaacaacaacttcatatcgacggttgctcggagcaatttccagccgtatggacgtgattttctgggtgg |
37385563 |
T |
 |
| Q |
211 |
gaag |
214 |
Q |
| |
|
|||| |
|
|
| T |
37385562 |
gaag |
37385559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 63; Significance: 2e-27; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 89 - 203
Target Start/End: Original strand, 36599013 - 36599127
Alignment:
| Q |
89 |
agtgctaaggttccggcgatcatagtgttcggcgactcatccgtggatgccgggaacaacaacttcatatcgacggttgctcggagcaatttccagccgt |
188 |
Q |
| |
|
||||| ||||||||||| || || |||||||| ||||| ||||| ||||||||||| ||||||||||| |||||||||| ||||||||||| ||||||| |
|
|
| T |
36599013 |
agtgcaaaggttccggcaataatcgtgttcggagactcttccgttgatgccgggaataacaacttcattccgacggttgcacggagcaattttcagccgt |
36599112 |
T |
 |
| Q |
189 |
atggacgtgattttc |
203 |
Q |
| |
|
|||||||||| |||| |
|
|
| T |
36599113 |
atggacgtgactttc |
36599127 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University