View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11160_low_16 (Length: 337)
Name: NF11160_low_16
Description: NF11160
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11160_low_16 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 278; Significance: 1e-155; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 278; E-Value: 1e-155
Query Start/End: Original strand, 1 - 325
Target Start/End: Original strand, 41761345 - 41761670
Alignment:
| Q |
1 |
ccaatttgcttctagtcatatgattcattagaggatccactttaaactaaaaaagattgtatcatttcataagaaatgatagatgacgggatttaatcca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41761345 |
ccaatttgcttctagtcatatgattcattagaggatccactttaaactaaaaaagattgtatcatttcataagaaatgatagatgacgggatttaatcca |
41761444 |
T |
 |
| Q |
101 |
aggttactcattttagtactactcttgttcgaatataattaacaatagagttcttctgatggtatccaattaattggtacttttatgacaagatta-aaa |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||| ||||||||||| ||||| ||| |
|
|
| T |
41761445 |
aggttactcattttagtactactcttgttcgaatataattaacaaaagagttcttctgatagtatccaattaattggtgcttttatgacatgattacaaa |
41761544 |
T |
 |
| Q |
200 |
acatatagtgccgtcttaatttttagctttacttaattatattattgacctttctaattagttaggactatatgtgattttggtttttctcttattctca |
299 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41761545 |
acatatagtgccgtcttaatatttagctttacttaattatattattgacctctctaattagttaggactatatgtgattttggtttttctcttattctca |
41761644 |
T |
 |
| Q |
300 |
atcctctctcattttaattgtggtct |
325 |
Q |
| |
|
|||| ||| || ||||||| |||||| |
|
|
| T |
41761645 |
atccactcccaatttaattttggtct |
41761670 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University