View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11160_low_22 (Length: 261)
Name: NF11160_low_22
Description: NF11160
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11160_low_22 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 1 - 252
Target Start/End: Original strand, 42462908 - 42463159
Alignment:
| Q |
1 |
aatgtcaaatatatgctgatttttacatatccatttgtggacctgaacctgatgtcacattctacctgctcctacatattttataatcttcatatcagta |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42462908 |
aatgtcaaatatatgctgatttttacatatccattcgtggacctgaacctgatgtcacattctacctgctcctacatattttataatcttcatatcagta |
42463007 |
T |
|
| Q |
101 |
tccgcttttttatcatttctctttcttaaatcaaaggtttcatccctaacgatggactaaagtacatttttgttgatttaattttaacgtttgcacttag |
200 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42463008 |
tccgcttttttatcatttatctttcttaaatcaaaggtttcatccctaacgatggattaaagtacatttttgttgatttaattttaacgtttgcacttag |
42463107 |
T |
|
| Q |
201 |
ggtgttgacctttttgcctttaattttaccttgtaatctgttaggttcttct |
252 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42463108 |
ggtgctgacctttttgcctttaattttaccttgtaatctgttaggttcttct |
42463159 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University