View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11160_low_25 (Length: 214)
Name: NF11160_low_25
Description: NF11160
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11160_low_25 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 177; Significance: 1e-95; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 177; E-Value: 1e-95
Query Start/End: Original strand, 19 - 203
Target Start/End: Complemental strand, 32539587 - 32539403
Alignment:
| Q |
19 |
agcacaagcagagagatgagaatttggtattccacatgttgttgcaacttgtaaactattggaatttaattctgcaattatggttaaaagctcaattgaa |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32539587 |
agcacaagcagagagatgagaatttggtattccgcatgttgttgcaacttgtaaactattggaatttaattctgcaattatggttaaaagctcaattgaa |
32539488 |
T |
|
| Q |
119 |
ttcctcaaactttttatcttaagctcttttattgtcccttgatcatgtactaacttgtcaatattctcaatactcagtttcatct |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
32539487 |
ttcctcaaactttttatcttaagctcttttattgtcccttgatcatgtactaacttgtcaatattctcaatactcaatttcatct |
32539403 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University