View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11163_low_14 (Length: 254)
Name: NF11163_low_14
Description: NF11163
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11163_low_14 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 1 - 246
Target Start/End: Original strand, 22325049 - 22325294
Alignment:
| Q |
1 |
catatttctttgcagcttctaataactcttgactataattcagaagatcctcgtctctcacgatatcgtagaagtaatctataaatatttgacatggtat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22325049 |
catatttctttgcagcttctaataactcttgactataattcagaagatcctcgtctctcacgatatcgtagaagtaatctataaatatttgacatggtat |
22325148 |
T |
|
| Q |
101 |
agttgtcatatctgagatgataatactatcagcagaatcctccttgaacatttggttaaaaacacttgactttgaaccaagagcaaacttatgggccata |
200 |
Q |
| |
|
||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
22325149 |
agttgtcatatctgagatggtaatactatcaacagaatcctccttgaacatttggttaaaagcacttgactttgaaccaagagcatacttatgggccata |
22325248 |
T |
|
| Q |
201 |
atagtttgtttagatgcatcaatatagattgttgtgtcttcatctc |
246 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
22325249 |
atagtttgtttagatgcatcaatatagatttttgtgtctttatctc |
22325294 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University