View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11163_low_15 (Length: 249)
Name: NF11163_low_15
Description: NF11163
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11163_low_15 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 226; Significance: 1e-125; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 226; E-Value: 1e-125
Query Start/End: Original strand, 12 - 249
Target Start/End: Complemental strand, 27808574 - 27808337
Alignment:
| Q |
12 |
agagaatacacaaactcaaacttagtcaaactgctgttggacttaccatctaacaatttagatatgatgatagtgacaagacaaagacacattcacaagt |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27808574 |
agagaatacacaaactcaaacttagtcaaactgctgttggatttaccatctaacaatttagatatgatgatagtgacaagacaaagacacattcacaagt |
27808475 |
T |
 |
| Q |
112 |
tctcatgcgttgaaatgtcgggacaaagactatgttactgaaagaatacaccaacacttgctaaatgttgctagaactaggactttaatcttccaatcaa |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
27808474 |
tctcatgcgttgaaatgtcgggacaaagactatgttacggaaagaatacaccaacacttgctaaatgttgctagaactaggactttaatcttccagtcaa |
27808375 |
T |
 |
| Q |
212 |
aatttatgtcattttggagaagaatgtgtaccggttgc |
249 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27808374 |
aatttatgtcattttggagaagaatgtgtaccggttgc |
27808337 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University