View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11163_low_17 (Length: 214)
Name: NF11163_low_17
Description: NF11163
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11163_low_17 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 1 - 214
Target Start/End: Complemental strand, 27808137 - 27807924
Alignment:
| Q |
1 |
cattggagaactggtaccaagtagttgacattttcacaaagcattgcatattgaagattgtatgtatatgtacacatgtatatatcaatttggatcaatc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27808137 |
cattggagaactggtaccaagtagttgacattttcacaaagcattgcatattgaagattgtatgtatatgtacacatgtatatatcaatttggatcaatc |
27808038 |
T |
 |
| Q |
101 |
aatgctaacaattattttctcctcgatttgtttctgtttcacggttactttttgtcatgtcttcttttctagctgctaccaaattgagagatcatgagac |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27808037 |
aatgctaacaattattttctcctcgatttgtttctgtttcacggttactttttgtcatgtcttcttttctagctgctaccaaattgagagatcatgagac |
27807938 |
T |
 |
| Q |
201 |
accgaaattctaca |
214 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
27807937 |
accgaaattctaca |
27807924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University