View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11164_high_11 (Length: 294)
Name: NF11164_high_11
Description: NF11164
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11164_high_11 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 217; Significance: 1e-119; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 1 - 229
Target Start/End: Original strand, 26838579 - 26838807
Alignment:
| Q |
1 |
tgtctttaagcaacaattgccctcctggaacatatatatgatgagcaacttgagtcatttgaccaattgttatgatttcataaaactgttgagggggaat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
26838579 |
tgtctttaagcaacaattgccctcctggaacatatatatgatgaacaacttgagtcatttgaccaattgttatgatttcataaaactgttgaggggaaat |
26838678 |
T |
|
| Q |
101 |
ggatctgaggtttgttgacttcacacatatatcaattttggatctgattgaagtgaaggaatattaaggaattacttctaaaattgatttgcaataggcc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
26838679 |
ggatctgaggtttgttgacttcacacatatatcaattttggatctgattgaagtgaaggaatattaaggaattactactaaaattgatttgcaataggcc |
26838778 |
T |
|
| Q |
201 |
aatgacaaaagaaacaattgcgtttatgt |
229 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
26838779 |
aatgacaaaagaaacaattgcgtttatgt |
26838807 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 226 - 284
Target Start/End: Original strand, 26838834 - 26838892
Alignment:
| Q |
226 |
atgttgtactcttttgctttgttttggttgctacgtcaactgtgtgcataatgtctgtg |
284 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26838834 |
atgttgtactcttttgctttgttttggttgctacgtcaactgtgtgcataatgtctgtg |
26838892 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University