View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11164_low_13 (Length: 267)
Name: NF11164_low_13
Description: NF11164
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11164_low_13 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 136; Significance: 5e-71; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 136; E-Value: 5e-71
Query Start/End: Original strand, 1 - 252
Target Start/End: Complemental strand, 24224663 - 24224408
Alignment:
| Q |
1 |
tttcatagaataccaataacttaacactgagttatctattagctaagctactaactcaagttttctatannnnnnnnnnnnncttatgtatcttaatgcg |
100 |
Q |
| |
|
||||||||||||||||||||| |||||| ||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||| |
|
|
| T |
24224663 |
tttcatagaataccaataactcaacactcagttatctattagctaagctactgactcaagttttctatatttttttgtttttcttatgtatcttaatgca |
24224564 |
T |
 |
| Q |
101 |
ctcggatttcttcatgtgcgctctttgtattggggagaatcttttgtggtaatatattccattttggtcagttt----nnnnnnnnnnnnttatatgtca |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||| |
|
|
| T |
24224563 |
ctcggatttcttcatgtgcgctctttgtattggggagaatcttttgtggtaatatattccattttggtcggtttaagaagaaaaaaaattatatatgtca |
24224464 |
T |
 |
| Q |
197 |
cgttgatgaattgaatatgatatttattttgaatggttgtaataaatcgttccaac |
252 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24224463 |
cattgatgaattgaatatgatatttattttgaatggttgtaataaatcgttccaac |
24224408 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University