View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11166_low_10 (Length: 361)
Name: NF11166_low_10
Description: NF11166
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11166_low_10 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 25 - 326
Target Start/End: Complemental strand, 22765521 - 22765218
Alignment:
| Q |
25 |
tgtgattgtgaaccgacctttgccatgacaggtgcgcttgcatggcaggtcnnnnnnnnnnnnnnnnnnnntattttgttgtttctgaggaagatcgcac |
124 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||| |
|
|
| T |
22765521 |
tgtgattgtggaccgacctttgccatgacaggtgcgcttgcatggcacgtcaaaaaaatgaataaaaaaaatattttgttgtttctgaggaagatcgcac |
22765422 |
T |
 |
| Q |
125 |
gggaattgcccgggatcttcctcaggtgtggtggtgtgtg--atcttctttttcttcttgttgtgctttaatttatctttattgatataccacgcataac |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
22765421 |
gggaattgcccgggatcttcctcaggtgtggtggtgtgtgtgatcttctttttcttcttgttgtgctttaatttatctttattgatataccacgcatagc |
22765322 |
T |
 |
| Q |
223 |
aaagaaacaaatgataacactgatcgcaaaggatttatcaccatcactgaattttctccgttgctggttgattaaggtatcatttattagtttaccttcg |
322 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
22765321 |
aaagcaacaaatgataacactgatcgcaaaggatttatcaccatcactgaattttctccgttgctgattgattaaggtatcatttattagtttaccttca |
22765222 |
T |
 |
| Q |
323 |
aatt |
326 |
Q |
| |
|
|||| |
|
|
| T |
22765221 |
aatt |
22765218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 122; Significance: 2e-62; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 122; E-Value: 2e-62
Query Start/End: Original strand, 23 - 287
Target Start/End: Complemental strand, 33081360 - 33081095
Alignment:
| Q |
23 |
tatgtgattgtgaaccgacctttgccatgacaggtgcgcttgcatggcaggtcnnnnnnnnnnnnnnnnnnnntattttgttgtttctgaggaagatcgc |
122 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
33081360 |
tatgttattgtgaaccgacctttgccatgacaggtgcgcttgcatggcaggtaaaaaaaaatgaataaaaaaatattttgttgtttctgaggaagatcgc |
33081261 |
T |
 |
| Q |
123 |
acgggaattgcccgggatcttcctcaggtgtggtggtgtgtg-atcttctttttcttcttgttgtgctttaatttatctttattgatataccacgcataa |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| | |||| ||||||| ||| |||||| |||||||||||||| ||||||||||| | |
|
|
| T |
33081260 |
acgggaattgcccgggatcttcctcaggtgtggtggtgtgtgtgtgatcttcttcttctcgttatgctttcttttatctttattgacataccacgcatca |
33081161 |
T |
 |
| Q |
222 |
caaagaaacaaatgataacactgatcgcaaaggatttatcaccatcactgaattttctccgttgct |
287 |
Q |
| |
|
||||||||||||| ||||||||||||| ||||||||||| || ||||| | ||||||||| ||||| |
|
|
| T |
33081160 |
caaagaaacaaatcataacactgatcgtaaaggatttattactatcacaggattttctccattgct |
33081095 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 69; E-Value: 7e-31
Query Start/End: Original strand, 110 - 316
Target Start/End: Complemental strand, 33095825 - 33095609
Alignment:
| Q |
110 |
tgaggaagatcgcacgggaattgcccgggatcttcctcaggtgtggtggtgtgtga---tcttctttttcttcttgttgtgctttaatttatctttattg |
206 |
Q |
| |
|
|||||||||||||| ||||||| ||||||||||||| | | |||||||||||||| | |||| ||||||| ||| |||||| ||||||||||||| |
|
|
| T |
33095825 |
tgaggaagatcgcatgggaatttcccgggatcttcccctgctgtggtggtgtgtgtgtgtgatcttcttcttctggttatgctttcgtttatctttattg |
33095726 |
T |
 |
| Q |
207 |
atataccacgcataacaa-------agaaacaaatgataacactgatcgcaaaggatttatcaccatcactgaattttctccgttgctggttgattaagg |
299 |
Q |
| |
|
||||||||||||| |||| |||||||||| |||||||| | ||||||||||||||| ||||||| ||||||| ||||| || ||| ||||| |
|
|
| T |
33095725 |
atataccacgcatcacaattcacaaagaaacaaattataacacttgccacaaaggatttatcactatcactggattttctacgttgttgactgaataagg |
33095626 |
T |
 |
| Q |
300 |
tatcatttattagttta |
316 |
Q |
| |
|
|||||||||||| |||| |
|
|
| T |
33095625 |
tatcatttattacttta |
33095609 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 35 - 74
Target Start/End: Complemental strand, 33095886 - 33095847
Alignment:
| Q |
35 |
aaccgacctttgccatgacaggtgcgcttgcatggcaggt |
74 |
Q |
| |
|
|||||||||||||||||| ||| ||||||||||||||||| |
|
|
| T |
33095886 |
aaccgacctttgccatgataggcgcgcttgcatggcaggt |
33095847 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 37 - 75
Target Start/End: Original strand, 7655758 - 7655796
Alignment:
| Q |
37 |
ccgacctttgccatgacaggtgcgcttgcatggcaggtc |
75 |
Q |
| |
|
||||||||||||||| ||||||||||||| ||||||||| |
|
|
| T |
7655758 |
ccgacctttgccatgtcaggtgcgcttgcttggcaggtc |
7655796 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 42 - 75
Target Start/End: Original strand, 6926526 - 6926559
Alignment:
| Q |
42 |
ctttgccatgacaggtgcgcttgcatggcaggtc |
75 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| |
|
|
| T |
6926526 |
ctttgccatgtcaggtgcgcttgcatggcaggtc |
6926559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University