View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11166_low_12 (Length: 301)
Name: NF11166_low_12
Description: NF11166
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11166_low_12 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 17 - 290
Target Start/End: Original strand, 11695498 - 11695777
Alignment:
| Q |
17 |
agtatatctaaaatccaaacatacacatgtcaatatataagaggtctttaacttgcaagaagactttagtgggaccaaacattatcctatcctcatatcc |
116 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11695498 |
agtatatctaaaattcaaacatacacatgtcaatatataagaggtctttaacttgcaagaagactttagtgggaccaaacattatcctatcctcatatcc |
11695597 |
T |
|
| Q |
117 |
tttgtcccataataatcccataatgtaacattgtggtctcaaatcttcttcgaaatttcatggatcacattcaaattctc-----------------tct |
199 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
11695598 |
tttg-----------tcccataatgtaacattgtggtctcaaatcttcttcgaaatttcatggatcacattcaaattctctctaatatacaaacacttct |
11695686 |
T |
|
| Q |
200 |
caaaattcacgttttcttttcacaaataatgaatgcttttcacacttcttcacaataaccagctcatcaactttcaaatgaaatgattcat |
290 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11695687 |
caaaattcacgttttcttttcacaaataatgaatgcttttcacacttcttcacaataaccagctcatcaactttcaaatgaaatgattcat |
11695777 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University