View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11166_low_7 (Length: 443)
Name: NF11166_low_7
Description: NF11166
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11166_low_7 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 259; Significance: 1e-144; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 259; E-Value: 1e-144
Query Start/End: Original strand, 28 - 425
Target Start/End: Complemental strand, 30419454 - 30419077
Alignment:
| Q |
28 |
ttcacacaaagcggaggttaggggacgatgataggttacatcaatcatctttctcatattaccacattatttttcttcacaaacttcccagatggtgata |
127 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
30419454 |
ttcacacaaagcggaggttaggggacggtgataggttacatcaatcatctttctcatattaccacattatttttcttcacaaacttctcagatggtgata |
30419355 |
T |
 |
| Q |
128 |
gagtggtggatctttgagggnnnnnnnnnctttctaaattcgggagagtgcgagaggtgtatatttcaaaaaagcttaataaatgggggaggaggcttgg |
227 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
30419354 |
gagtggtggatctttgagggtttttttt-ctttctaaattcaggagagtgcgagaggtgtatatttcaaaaaagcttgataa------------------ |
30419274 |
T |
 |
| Q |
228 |
ggttctgaaatttagggatgtaaaaggaagtagatgtgtggagtaagaaactgaaatcggtatggtgtaggtgtttcaatcgtaaggtcaacctctcaag |
327 |
Q |
| |
|
| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
30419273 |
gaaactgaaatttagggatgtaaa-ggaagtagatgtgtggagtaagaaactgaaatcggtatggtgtaggtgtttcaatcgcaaggtcaacctctcaag |
30419175 |
T |
 |
| Q |
328 |
gcttgataagaatgattgggggttaggacaggactatggcaaacataaaggaaataacgaatggtgaggctttacagggaaggagaggaaggtccaac |
425 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
30419174 |
gcttgataagaatgattgggggttaggacaggactgtggcaaacataaaggaaataacgaatggcgaggctttacagggaaggagaggaaggtccaac |
30419077 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University