View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11167_high_15 (Length: 231)
Name: NF11167_high_15
Description: NF11167
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11167_high_15 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 1 - 225
Target Start/End: Complemental strand, 47067789 - 47067568
Alignment:
| Q |
1 |
tctattttgtggttaacaaaagtatgaaatggacagttgattggtggaattggcttcttcttctacaagaagatataaaatgtttgaaaagggcactgta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
47067789 |
tctattttgtggttaacaaaagtatgaaatggacagttgattggtggaattggcttcttcttctacaaga---tataaaatgtttgaaaagggcactgta |
47067693 |
T |
 |
| Q |
101 |
ccaacaacaaattttaattcatgatcattatacaaaggaatttaaaatgtcattaaatatccttttcaataaaaatgtcacaaaatatgaattgacattt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47067692 |
ccaacaacaaattttaattcatgatcattatacaaaggaatttaaaatgtcattaaatatccttttcaataaaaatgtcacaaaatatgaattgacattt |
47067593 |
T |
 |
| Q |
201 |
gcaaaatcttcacccttgtctaagc |
225 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
47067592 |
gcaaaatcttcacccttgtctaagc |
47067568 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University