View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11167_high_7 (Length: 357)
Name: NF11167_high_7
Description: NF11167
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11167_high_7 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 320; Significance: 1e-180; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 320; E-Value: 1e-180
Query Start/End: Original strand, 4 - 342
Target Start/End: Original strand, 41495056 - 41495395
Alignment:
| Q |
4 |
ggaattgccaaaattggggccttttattgtcaaccttttatgagaagtaatatgcaattttgatttctagttaagttaatgattgactaggagccctaaa |
103 |
Q |
| |
|
||||| |||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41495056 |
ggaatggccaaaattgggcccttttattgtcaaccttttgtgagaagtaatatgcaattttgatttctagttaagttaatgattgactaggagccctaaa |
41495155 |
T |
 |
| Q |
104 |
acaagattaagaagaagaaaataactactcaaaagggagggaattgaaaatcctgcatgggtggcgagtcctctcatgcccttaattatcgctccaatct |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41495156 |
acaagattaagaagaagaaaataactactcaaaagggagggaattgaaaatcctgcatgggtggcgagtcctctcatgcccttaattatcgctccaatct |
41495255 |
T |
 |
| Q |
204 |
caatggtgttttaagtgtaagt-gggccacacattatactccactccacaaccaaacaattttccctttctcttgttttttctcttttggttgaatcttt |
302 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41495256 |
caatggtgttttaagtgtaagtggggccacacattatactccactccacaaccaaacaattttccctttctcttgttttttctcttttggttgaatcttt |
41495355 |
T |
 |
| Q |
303 |
gatgactatttaaccatgtttgggtaaaaactttatatct |
342 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41495356 |
gatgactatttaaccatgtttgggtaaaaactttatatct |
41495395 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University