View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11168_high_30 (Length: 347)
Name: NF11168_high_30
Description: NF11168
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11168_high_30 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 150; Significance: 3e-79; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 150; E-Value: 3e-79
Query Start/End: Original strand, 61 - 251
Target Start/End: Complemental strand, 11402268 - 11402074
Alignment:
| Q |
61 |
tcattataaaattaatacatactcaatattttgctta----cataattagattgtgaattttaggtttgttccttcaatatttgaagaaattttcagcaa |
156 |
Q |
| |
|
||||||||| |||||||||||||||||| ||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11402268 |
tcattataaggttaatacatactcaatatgttgcttaattacatagttagattgtgaattttaggtttgttccttcaatatttgaagaaattttcagcaa |
11402169 |
T |
|
| Q |
157 |
gcatgcacggaaacacccaagtgctttaacttctgatgaattgatggggctgctgaaggccaatagagagcctaaggattacaaaggatggtaag |
251 |
Q |
| |
|
||||||| | |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11402168 |
gcatgcaagaaaacacccaagtgctttaacttctgatgaattgatggggctgttgaaggccaatagagagcctaaggattacaaaggatggtaag |
11402074 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 296 - 324
Target Start/End: Complemental strand, 11402030 - 11402002
Alignment:
| Q |
296 |
gttaccatgatatattgatacgaagtttc |
324 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
11402030 |
gttaccatgatatattgatacgaagtttc |
11402002 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University