View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11168_high_41 (Length: 302)
Name: NF11168_high_41
Description: NF11168
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11168_high_41 |
 |  |
|
| [»] scaffold0121 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0121 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: scaffold0121
Description:
Target: scaffold0121; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 16 - 292
Target Start/End: Original strand, 27795 - 28071
Alignment:
| Q |
16 |
atattttcgccgtaagagacataacttactcctccaacactctccttgataccttggatagcccgaaaaacctcttccttaacttcaccgttcttttcgt |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
27795 |
atattttcgccgtaagagacataacttactcctccaacactctccttgataccttggatagcccgaaaaacctcctccttaacttcaccgttcttttcgt |
27894 |
T |
 |
| Q |
116 |
ccttgagtttcaagaaactcacacgaaaagcagtccccagtgaggggtgcgggggaagagttacttcccctgcaatccaatcgacgactaaaaggtcgtc |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||| || ||||||||||||| |||||||| ||||||||||||| |||||| |||||||| |
|
|
| T |
27895 |
ccttgagtttcaagaaactcacacgaaaagcagtccccggtgaaggatgcgggggaagagcaacttcccccgcaatccaatcgatgactaagaggtcgtc |
27994 |
T |
 |
| Q |
216 |
aaggatagggagtgcgaagtttcttacgccgttgaggtgggtagggtgagcgttgtatatttgaagatcctcctttg |
292 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27995 |
gagaatagggagtgcgaagtttcttacgccgttgaggtgggtagggtgagcgttgtatatttgaagatcctcctttg |
28071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University