View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11168_high_47 (Length: 268)
Name: NF11168_high_47
Description: NF11168
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11168_high_47 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 52; Significance: 7e-21; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 69 - 120
Target Start/End: Complemental strand, 54471978 - 54471927
Alignment:
| Q |
69 |
attgtgatggttgagatggggaagtgttagaaggtggagtcggagacggaga |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54471978 |
attgtgatggttgagatggggaagtgttagaaggtggagtcggagacggaga |
54471927 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 5 - 44
Target Start/End: Complemental strand, 54472042 - 54472003
Alignment:
| Q |
5 |
ggaggcaatggtgagttgttaggtggagcctgtgatgact |
44 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54472042 |
ggaggcaatggtgagttgttaggtggagcctgtgatgact |
54472003 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University