View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11168_high_47 (Length: 268)

Name: NF11168_high_47
Description: NF11168
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11168_high_47
NF11168_high_47
[»] chr3 (2 HSPs)
chr3 (69-120)||(54471927-54471978)
chr3 (5-44)||(54472003-54472042)


Alignment Details
Target: chr3 (Bit Score: 52; Significance: 7e-21; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 69 - 120
Target Start/End: Complemental strand, 54471978 - 54471927
Alignment:
69 attgtgatggttgagatggggaagtgttagaaggtggagtcggagacggaga 120  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||    
54471978 attgtgatggttgagatggggaagtgttagaaggtggagtcggagacggaga 54471927  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 5 - 44
Target Start/End: Complemental strand, 54472042 - 54472003
Alignment:
5 ggaggcaatggtgagttgttaggtggagcctgtgatgact 44  Q
    ||||||||||||||||||||||||||||||||||||||||    
54472042 ggaggcaatggtgagttgttaggtggagcctgtgatgact 54472003  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University