View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11168_high_57 (Length: 251)
Name: NF11168_high_57
Description: NF11168
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11168_high_57 |
 | |
|
| [»] scaffold0121 (2 HSPs) |
| | |
|
Alignment Details
Target: scaffold0121 (Bit Score: 79; Significance: 5e-37; HSPs: 2)
Name: scaffold0121
Description:
Target: scaffold0121; HSP #1
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 1 - 108
Target Start/End: Original strand, 28319 - 28426
Alignment:
| Q |
1 |
tctggacggtggagattgatggtagggtttgaatgatgtggagagnnnnnnngcttgtttgaatggcgagaatgtgaaggaaagtggtgaacaagttctt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
28319 |
tctggacggtggagattgatggtagggtttgaatgatgtggagagtttttttgcttgtttgaatggtgagaatgtgagggaaagtggtgaacaagttctt |
28418 |
T |
|
| Q |
101 |
agacttag |
108 |
Q |
| |
|
|||||||| |
|
|
| T |
28419 |
agacttag |
28426 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0121; HSP #2
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 167 - 245
Target Start/End: Original strand, 28488 - 28566
Alignment:
| Q |
167 |
tatagggttgttaagttaggatatcaaatctagttgatgataatgtgtttcacttttatattgtttcattcatctcact |
245 |
Q |
| |
|
||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
28488 |
tatagggttgttaagctgggatatcaaatctagttgatgataatgtgtttcacttttatattgtttcattcatttcact |
28566 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University