View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11168_high_59 (Length: 249)
Name: NF11168_high_59
Description: NF11168
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11168_high_59 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 204; Significance: 1e-111; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 1 - 239
Target Start/End: Original strand, 37481490 - 37481729
Alignment:
| Q |
1 |
caagagtgagacgaaacatagagagatgcatatcttgtaagcttgtcaagagctcattacatagggtcaaggaggacgttatgtcgtaatggtgtgataa |
100 |
Q |
| |
|
|||||| |||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
37481490 |
caagagcgagacgaaacatagagagatacatatcttgtaagtttgtcaagagctcattacatagggtcaaggaggacgttatgtcgtaatgacgtgataa |
37481589 |
T |
 |
| Q |
101 |
tgtggcaaccattatggaaggatgcccataaaagtgataaatgatagtcattatgagcca-ccagccatgacaatatgaggcttcattgaggcagagaga |
199 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
37481590 |
tgcggcaaccattatggaaggatgcccataaaagtgataaatgatagtcattatgagccacccagccatgacaatatgaggcttcattgaggcggagaga |
37481689 |
T |
 |
| Q |
200 |
atccgaggtgagaaggatattctactcacttaggtctgtg |
239 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37481690 |
atccgaggtgagaaggatattctactcacttaggtctgtg |
37481729 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 22 - 109
Target Start/End: Complemental strand, 5527122 - 5527035
Alignment:
| Q |
22 |
agagatgcatatcttgtaagcttgtcaagagctcattacatagggtcaaggaggacgttatgtcgtaatggtgtgataatgtggcaac |
109 |
Q |
| |
|
|||||| |||||||||| |||||||||||| ||| ||| |||||||||||||| |||||| ||||||||||||||||| |||||| |
|
|
| T |
5527122 |
agagatacatatcttgtgagcttgtcaagaactctttatatagggtcaaggagacatttatgtggtaatggtgtgataatggggcaac |
5527035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 174 - 230
Target Start/End: Original strand, 28355127 - 28355183
Alignment:
| Q |
174 |
tatgaggcttcattgaggcagagagaatccgaggtgagaaggatattctactcactt |
230 |
Q |
| |
|
|||| |||||||||||| ||||| ||||||||||||||||| ||||||||||||| |
|
|
| T |
28355127 |
tatgtggcttcattgagttagagaagatccgaggtgagaaggagattctactcactt |
28355183 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University