View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11168_high_65 (Length: 242)
Name: NF11168_high_65
Description: NF11168
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11168_high_65 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 141; Significance: 5e-74; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 141; E-Value: 5e-74
Query Start/End: Original strand, 19 - 183
Target Start/End: Complemental strand, 16825871 - 16825707
Alignment:
| Q |
19 |
aaatggaaaataagaaagggttggtttttatttggcactcgtacttagatcccttacggcggttgtatggtgctgcagtcataccgaccattaaatttat |
118 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16825871 |
aaatggaaaataagaaagggttggttttcatttggcactcgtacttagatcccttacggaggttgtatggtgctgcagtcataccgaccattaaatttat |
16825772 |
T |
|
| Q |
119 |
aaaaagaagctttttctctctaaatgtaatggttgttttggttgttgcaccatacaacggccgta |
183 |
Q |
| |
|
||| ||||||||| ||||||||||||||||||||||| |||||||||||||||||| |||||||| |
|
|
| T |
16825771 |
aaagagaagctttctctctctaaatgtaatggttgttatggttgttgcaccatacagcggccgta |
16825707 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University