View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11168_high_69 (Length: 240)
Name: NF11168_high_69
Description: NF11168
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11168_high_69 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 15 - 220
Target Start/End: Complemental strand, 1702342 - 1702137
Alignment:
| Q |
15 |
agcagagatatccaaagactccaagattaagataattaggagtggaaccaaacagaatttcattaggacatttgtttttaagatgtgttgttgtcatgcg |
114 |
Q |
| |
|
|||| ||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||| |
|
|
| T |
1702342 |
agcacagacatccaaagactcgaagattaagataattaggagtggaaccaaacagaatttcatgaggacatttgtttttaagatgtgttgttggcatgcg |
1702243 |
T |
|
| Q |
115 |
atttattaaatacaccgccatttggaaggcataacaccagaatttttgtggaacatgagagtgagacatgagggtgagcgatgtttctactatatgacga |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1702242 |
atttattaaatacaccgccatttggaaggcataacaccagaatttttgtggaacatgagagtgagacatgagggtgagcgatgtttctactatatgacga |
1702143 |
T |
|
| Q |
215 |
tgtttg |
220 |
Q |
| |
|
|||||| |
|
|
| T |
1702142 |
tgtttg |
1702137 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University