View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11168_high_71 (Length: 239)
Name: NF11168_high_71
Description: NF11168
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11168_high_71 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 15 - 222
Target Start/End: Complemental strand, 54416151 - 54415944
Alignment:
| Q |
15 |
caaagggaagcaaagtaacaagtaaaatttgatgttaatcactcgaaaattaccgctggatgtgtggaaggggagtagggagcctgtgtttaccttatat |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54416151 |
caaagggaagcaaagtaacaagtaaaatttgatgttaatcactcgtaaattaccgctggatgtgtggaaggggagtagggagcctgtgtttaccttatat |
54416052 |
T |
 |
| Q |
115 |
agcttataagcccacagccaataacaattcataactaactgactggagttagcagctgtattgtcaatacagtattgacaggagcactggatgtgctagg |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
54416051 |
agcttataagcccacagccaataacaattcataactaactgactggagttggcagctgtattgtcaatacagtattgacaggagcactggatgtgcaagg |
54415952 |
T |
 |
| Q |
215 |
agaacagt |
222 |
Q |
| |
|
|||||||| |
|
|
| T |
54415951 |
agaacagt |
54415944 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University