View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11168_high_81 (Length: 222)
Name: NF11168_high_81
Description: NF11168
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11168_high_81 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 139; Significance: 7e-73; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 139; E-Value: 7e-73
Query Start/End: Original strand, 22 - 204
Target Start/End: Complemental strand, 41230709 - 41230534
Alignment:
| Q |
22 |
tggagaatagtcaaacttgcatgtgcaagtattgatgcatttttgagactgcaatttgcagaatagctctttctcatgagtcgaa-aaaatcttattgta |
120 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
41230709 |
tggagaatactcaaacttgcatgtgcaagtattgatgcatttttgagactgcaatttggagaatagctctttctcatgagtcgaaaaaaatcttattgta |
41230610 |
T |
|
| Q |
121 |
gtgaaagacagaaatttacctccagttcgactgtcctgcatgatccaatgtctgccctaaacgaatgccaacttcttgtgtctt |
204 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41230609 |
gt--------gaaatttacctccagttcgactgtcctgcatgatccaatgtctgccctaaacgaatgccaacttcttgtgtctt |
41230534 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 22 - 77
Target Start/End: Complemental strand, 42414393 - 42414337
Alignment:
| Q |
22 |
tggagaatagtcaaacttgcatgtgcaagta-ttgatgcatttttgagactgcaatt |
77 |
Q |
| |
|
|||||||| ||||||||||| ||||||| | |||||| |||||||||||||||||| |
|
|
| T |
42414393 |
tggagaatggtcaaacttgcctgtgcaatcaattgatgaatttttgagactgcaatt |
42414337 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University