View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11168_high_89 (Length: 202)
Name: NF11168_high_89
Description: NF11168
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11168_high_89 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 182; Significance: 1e-98; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 182; E-Value: 1e-98
Query Start/End: Original strand, 1 - 190
Target Start/End: Complemental strand, 6007000 - 6006811
Alignment:
| Q |
1 |
tatatctcggatcgattgctttcatctattgcagagaaaggatttcctttaaggaagcttgtgcttcaaggttgccttgactattcctatgttggactct |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6007000 |
tatatctcggatcgattgctttcatctattgcagagaaaggttttcctttaaggaagcttgtgcttcaaggttgccttgactattcctatgttggactct |
6006901 |
T |
 |
| Q |
101 |
ataacttgttgtctaattgtcattattttcaatatttggatcttcaaagtgctgattttctgaatgattcacatgtccttaagttgtctc |
190 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
6006900 |
ataacttgttgtctaattgtcattattttcaatatttggatcttcaaagtgctgattttctgaatgattcacacgtccttaagttgtctc |
6006811 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 88 - 189
Target Start/End: Original strand, 1527717 - 1527818
Alignment:
| Q |
88 |
tatgttggactctataacttgttgtctaattgtcattattttcaatatttggatcttcaaagtgctgattttctgaatgattcacatgtccttaagttgt |
187 |
Q |
| |
|
||||||||| ||| |||||| ||||| || ||||| | | ||||||||||||||||||||| | | | ||| ||||||||| |||||| || |||||| |
|
|
| T |
1527717 |
tatgttggaatctttaacttattgtcaaagtgtcaatttattcaatatttggatcttcaaaattccaagtttatgaatgatttgcatgtcattgagttgt |
1527816 |
T |
 |
| Q |
188 |
ct |
189 |
Q |
| |
|
|| |
|
|
| T |
1527817 |
ct |
1527818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 92 - 169
Target Start/End: Original strand, 12118828 - 12118905
Alignment:
| Q |
92 |
ttggactctataacttgttgtctaattgtcattattttcaatatttggatcttcaaagtgctgattttctgaatgatt |
169 |
Q |
| |
|
||||| ||| |||||| ||||| || ||||| | | ||||||||||||||||||||| |||| | ||| ||||||||| |
|
|
| T |
12118828 |
ttggaatctttaacttattgtcaaagtgtcaatttattcaatatttggatcttcaaaatgctaagtttatgaatgatt |
12118905 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University