View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11168_low_39 (Length: 310)
Name: NF11168_low_39
Description: NF11168
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11168_low_39 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 263; Significance: 1e-146; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 263; E-Value: 1e-146
Query Start/End: Original strand, 1 - 299
Target Start/End: Complemental strand, 10736780 - 10736482
Alignment:
| Q |
1 |
tacccttccaatgcatttcctttttcatcttcttattattactaccattagccatgcaaagactcataatcttctcggcagcctcaccctcatctttact |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10736780 |
tacccttccaatgcatttcctttttcatcttcttatcattattaccattagccatgcaaagactcataatcttctcggcagcctcaccctcatctttact |
10736681 |
T |
|
| Q |
101 |
actttgcatcaacttctcaacatctgcctttggaagtctcattttcaacctcacctcgccactcgtcaactcttcttttcccacctcgaagtcgttcatt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||| ||||||||||||||||| |||||||||||| |
|
|
| T |
10736680 |
actttgcatcaacttctcaacatctgcctttggaagtctcattttcaacctcaccccgccattcgtcaaatcttcttttcccacctcaaagtcgttcatt |
10736581 |
T |
|
| Q |
201 |
ggtttcatagtcgtaaggtcagaagctgaccttcgagctaaagacagactctcgagtctgtctttagcactcatattaatcactgaacgaactcttctt |
299 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||| |
|
|
| T |
10736580 |
ggtttcataatcgtaaggtcagaagctgaccttcgagctaaagacagactctcgagtctgtctttagcactcatattaatcaccgaacgaacccttctt |
10736482 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University